Нам очень нужны волонтеры молекулярные биологи и биоинформатики для помощи в наполнении и курировании портала. Напишите нам

Привет, я хочу извлечь все заголовки из моего файла fasta. Вот мой пример:

> Eukaryota; Alveolata; Dinoflagellata; Dinophyceae; Peridiniales; Kryptoperidiniaceae; Unruhdinium; Unruhdinium_kevei; ATGCTTGTCTCAAAGATTAAGCCA ...... и тд.

Все, что мне нужно, это извлечь строку, начинающуюся с «>», и разделить каждое имя (которое перед «;») на разные столбцы и поместить их в файл CSV.

спросил от (5.4k баллов)

1 Ответ

Это можно сделать с помощью командной строки. Grep выполнит поиск ">", а sed заменит ";"  табуляцией, создавая новые столбцы. Последний знак ">" выведет ваши результаты в новый файл имя файла, которое вы указали:

grep "^>" <filename> | sed 's/;/,/g' > <newfilename>

ответил от (5.4k баллов)